rs9846885 chr3:58300062 C>T
- Sequence
gctgggttggctgcccagttgagc[C/T]accctcagatgactggaggtgcct
- ASB in cell types
- IPSC-derived bipolar neuron bipolar neuron LNCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| IPSC-derived bipolar neuron | -1.52 | 1.90 | 1.00 | |||
| bipolar neuron | -1.59 | 1.92 | 1.00 | |||
| LNCaP (prostate carcinoma) | -0.58 | 1.62 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, college completion, infant head circumference, refractive error, rheumatoid arthritis, years of education
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid