rs984732 chr7:134755534 T>G
- Sequence
ttctattgggtggcttatctttct[T/G]cttattgatataggagtgatttat
- ASB in cell types
- RWPE2 LUHMES (lund human mesencephalic cells) GM18505 (female B-cells Lymphoblastoid Cell Lines) FT282 (normal human fallopian tube tissue)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| RWPE2 | -1.96 | 2.36 | 1.00 | |||
| LUHMES (lund human mesencephalic cells) | -0.72 | 1.89 | 1.00 | |||
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | -0.24 | 1.61 | 1.00 | |||
| FT282 (normal human fallopian tube tissue) | 1.49 | -0.52 | 1.00 |
Items per page:
1 – 4 of 4