rs9848177 chr3:98185413 G>A
- Sequence
cttggaagaacagcttgtccttgt[G/A]ttgtttagtttgcagcaccatctg
- ASB in cell types
- GM19193 (female B-cells Lymphoblastoid Cell Lines) RWPE2 GM02630 (Fanconi anemi) 2588 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | 1.74 | -3.20 | 1.50 | |||
| RWPE2 | 2.36 | -2.38 | 1.00 | |||
| GM02630 (Fanconi anemi) | -1.76 | 1.77 | 1.33 | |||
| 2588 (Lymphoblastoid Cell Lines) | -0.10 | 2.17 | 1.00 |
Items per page:
1 – 4 of 4