rs9848817 chr3:142033962 T>C
- Sequence
cttcccactgagttcatcttaaca[T/C]ttcaaatgcagagattgttccctt
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | -0.23 | 2.56 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, coronary artery disease (cad), gender differentiated, cystatin c in serum, hdl cholesterol, infant head circumference, irritible bowel syndrome, obesity with early age of onset (age >2), pr interval, serum creatinine, total cholesterol, triglycerides