rs9850546 chr3:161028731 G>C
- Sequence
atacatgacaccaacaacaaaaag[G/C]ctctcccgggtggtagaatgttag
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.87 | -0.01 | 1.95 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Tibial, Esophagus_Gastroesophageal_Junction, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg