rs9851127 chr3:125052388 C>A
- Sequence
gcgacagctatttaacagctcaga[C/A]ggggctcagctcaaagcgcttcct
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) HUVEC-C (HUVEC, umbilical vein endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CTV-1 (Adult T acute lymphoblastic leukemia) | 0.39 | 1.01 | 1.00 | |||
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | -0.03 | 1.32 | 1.50 |
Items per page:
1 – 2 of 2