rs985291 chr11:96909698 A>G
- Sequence
tacactctatgtgagcccaggcta[A/G]gtacctcttttttgtttgttggca
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- ZN507_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN507_HUMAN | n/a | 3.40 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, cystatin c in serum, hdl cholesterol change with statins, ldl cholesterol, serum creatinine, total cholesterol, triglycerides change with statins