rs9854347 chr3:196537385 G>A
- Sequence
ttgaacccgggaggcagaggttgc[G/A]gtgaaccgagatcgcaccactgca
- ASB in cell types
- ID00014 (lymphoblastoid cell, DiGeorge syndrome) gastroesophageal sphincter
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | 1.71 | -0.67 | 1.00 | |||
| gastroesophageal sphincter | 1.89 | -2.27 | 1.17 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Esophagus_Mucosa, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood