rs986878 chr5:103744350 A>T
- Sequence
aggattactactcattaaattaca[A/T]tgacctggagcactggccaaataa
- ASB in cell types
- breast tumor
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 1.78 | -4.45 | 2.00 | -0.60 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP college completion, fasting blood glucose, major depressive disorder (broad definition), major depressive disorder (broad definition) (females)