rs986909 chr3:124565054 A>G
- Sequence
ctgatggttaactgtgaactcaga[A/G]catatttaaaacactccggtgtct
- ASB in cell types
- A549 (lung carcinoma) neural progenitors WA01 (H1, human embryonic stem cells) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 1.42 | 0.25 | 2.02 | |||
| neural progenitors | -2.05 | 2.38 | 1.00 | |||
| WA01 (H1, human embryonic stem cells) | 1.30 | -0.61 | 1.20 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 1.18 | 0.98 | 1.02 | |||
| adrenal gland | -0.64 | 0.76 | 1.00 |
Items per page:
1 – 5 of 7
Motif analysis
No data available
Genetic associations
GRASP anti-tnf treatment response in rheumatoid arthritis (by das-28 score change at 3 months), chronic kidney disease, mitral annular calcium, paternal transmission distortion, serum creatinine, transmission distortion, urinary albumin-to-creatinine ratio