rs986911 chr3:124565146 A>C
- Sequence
ccactagatggcagcagcaggctg[A/C]attgtttgtgctgcatccagcctt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM10847 (female B-cells Lymphoblastoid Cell Lines) MCF7 (Invasive ductal breast carcinoma) neural cell
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | -0.19 | 0.57 | 1.05 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP anti-tnf treatment response in rheumatoid arthritis (by das-28 score change at 3 months), chronic kidney disease, mitral annular calcium, rheumatoid arthritis, serum creatinine, sporadic creutzfeldt-jakob disease, urinary albumin-to-creatinine ratio, variant creutzfeldt-jakob disease