rs986912 chr3:124565208 G>A
- Sequence
caccaggagaaaaatgtcagctaa[G/A]accgacgtcctaattctcctcgtg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM10847 (female B-cells Lymphoblastoid Cell Lines) neural cell MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- STAG1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.13 | 0.63 | 1.05 | n/a | n/a | |||
| CTCF_HUMAN | 0.47 | 0.62 | 1.45 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP anti-tnf treatment response in rheumatoid arthritis (by das-28 score change at 3 months), coronary artery disease (cad), mitral annular calcium, paternal transmission distortion, serum creatinine, transmission distortion, urinary albumin-to-creatinine ratio