rs989073 chr5:53037590 C>A
- Sequence
ttggaatagcctcttggtgatgtc[C/A]tagcctcttcttatgagggtgagt
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells)
- ASB for transcription factors
- JUND_HUMAN JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUND_HUMAN | -3.99 | 2.67 | 1.33 | n/a | No Hit | |||
| JUN_HUMAN | -4.08 | 2.62 | 1.33 | 3.25 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP hypertension (early onset hypertension), ldl cholesterol, maternal transmission distortion, transmission distortion, triglycerides change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Thyroid