rs990284 chr3:63289 A>G
- Sequence
gtcactctataaacttgttagatc[A/G]aaagtcacttatgcacttcatttc
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- FOXA2_HUMAN SOX13_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA2_HUMAN | 2.58 | n/a | 1.50 | n/a | No Hit | |||
| SOX13_HUMAN | 2.38 | -1.98 | 1.50 | -4.50 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, coronary artery disease (cad), fasting insulin, hip bone mineral density (bmd), maternal transmission distortion, paternal transmission distortion, transmission distortion, years of education
GTEx eQTL Liver, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis