rs990706 chr11:78424658 C>T
- Sequence
caacttaattttaacgatgttcta[C/T]tttaacaaccatcttgcaaaattc
- ASB in cell types
- K562 (myelogenous leukemia) MDM(monocyte derived macrophages) monocyte-derived macrophages from peripheral blood
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.19 | 0.71 | 1.99 | |||
| MDM(monocyte derived macrophages) | 1.89 | -0.35 | 3.00 | |||
| monocyte-derived macrophages from peripheral blood | 2.02 | n/a | 2.50 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, body mass index (bmi), ldl cholesterol, serum creatinine, total cholesterol, triglycerides
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Testis, Thyroid, Whole_Blood