rs991359 chr8:19227662 C>T
- Sequence
aaaaggtgccagagggtaattgga[C/T]tctggctctgacagttgatccaaa
- ASB in cell types
- IMR-5 (Neuroblastoma) liver
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| IMR-5 (Neuroblastoma) | n/a | 3.84 | 2.00 | |||
| liver | 2.04 | -0.20 | 1.20 |
Items per page:
1 – 2 of 2