rs991681 chr10:52653794 G>A
- Sequence
acagtgacatccagtgctaatacc[G/A]ttgatgtgagcctgaaataataac
- ASB in cell types
- adrenal gland
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| adrenal gland | 2.27 | -1.79 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alcohol consumption, diastolic blood pressure (dbp), resistance to kuru in aged women despite likely exposure, total cholesterol, total cholesterol change with statins