rs992813 chr8:6711741 C>T
- Sequence
cctctggaggccctagggggaatc[C/T]gttcttgtgggtttcaacttctgg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM12892 (female B-cells lymphoblastoid cell line) GM19239 (male B-cells lymphoblastoid cell line)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.41 | 1.56 | 1.26 | -0.91 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Caudate_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Lung, Testis