rs993706 chr5:64595319 T>C
- Sequence
ttcaggtatatggaacagcctgct[T/C]agctgccatttaggggctgagcat
- ASB in cell types
- tibial artery
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| tibial artery | 1.80 | -1.50 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, diastolic blood pressure (dbp), hip bone mineral density (bmd), longstanding arthritis, pulse pressure, salmonella-induced pyroptosis, spine bone mineral density (bmd), systolic blood pressure (sbp)
GTEx eQTL Adipose_Subcutaneous, Heart_Left_Ventricle, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis