rs994701 chr6:157461552 A>G
- Sequence
aaggcatttggattagtgaaatgc[A/G]gcctccctagtcctgcccctgagt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) CD34+ hematopoietic stem cells-derived proerythroblasts HEK293 (embryonic kidney) GM19239 (male B-cells lymphoblastoid cell line)
- ASB for transcription factors
- GATA1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA1_HUMAN | -1.20 | 2.25 | 2.00 | n/a | No Hit | |||
| CTCF_HUMAN | 1.18 | 0.41 | 1.07 | n/a | No Hit |
Items per page:
1 – 2 of 2