rs997476 chr4:102620848 G>T
- Sequence
accaaaaggaatgcaggagatcag[G/T]tggaaagctataatgggcctgaaa
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) A549 (lung carcinoma) 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12890 (Lymphoblastoid Cell Lines) | 0.67 | -0.67 | 1.00 | |||
| A549 (lung carcinoma) | 0.78 | 0.72 | 1.03 | |||
| 22RV1 (prostate carcinoma) | 2.48 | -1.70 | 2.00 |
Items per page:
1 – 3 of 3