rs997833 chr5:142455989 A>T
- Sequence
ctggtgctcatattcagccctttg[A/T]tccttaatatgcttgatttggaaa
- ASB in cell types
- macrophages form periferal blood monocytes from periferal blood TSU-1621-MT (adult acute myeloid leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| macrophages form periferal blood | 0.33 | 2.24 | 3.00 | |||
| monocytes from periferal blood | -0.26 | 1.63 | 1.00 | |||
| TSU-1621-MT (adult acute myeloid leukemia) | -2.43 | 2.54 | 1.00 |
Items per page:
1 – 3 of 3