rs998314 chr12:64826587 G>A
- Sequence
tgggctggaaacactcccgtggcc[G/A]ttgttatcaccgttctatgtttgg
- ASB in cell types
- HL-60 (acute myeloid leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HL-60 (acute myeloid leukemia) | -2.88 | 1.70 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP childhood acute lymphoblastic leukemia, college completion, hdl cholesterol change with statins, serum creatinine, tetrology of fallot
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Stomach, Whole_Blood