rs998909 chr3:52771077 A>G
- Sequence
gagcgactccgccaggctccgcgc[A/G]ctttctgtgcgtccgttccaccgt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) LNCaP (prostate carcinoma) GM19240 (B cells Lymphoblastoid Cell Lines) 2588 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- STAG1_HUMAN E2F1_HUMAN BCLF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 1.83 | -0.74 | 1.00 | n/a | n/a | |||
| E2F1_HUMAN | -1.12 | 1.92 | 1.17 | 3.30 | Concordant | |||
| BCLF1_HUMAN | 2.82 | n/a | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP adiponectin levels, birth weight, college completion, cystatin c in serum, hdl cholesterol, height, ldl cholesterol, refractive error, serum creatinine, total cholesterol, waist hip ratio, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Amygdala, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Whole_Blood