rs999557 chr5:151094519 T>G
- Sequence
cagcacattcctaccccaacggga[T/G]accaggcctcagggagaagtgatg
- ASB in cell types
- Detroit 562 (Pharyngeal squamous cell carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Detroit 562 (Pharyngeal squamous cell carcinoma) | -0.06 | 1.65 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP ldl cholesterol change with statins, paternal transmission distortion, schizophrenia, total cholesterol change with statins, transmission distortion