rs999742 chr15:73823176 G>A
- Sequence
aaacaggttgcttcctaaatcaac[G/A]ttgctgtccagggagcagcgctgt
- ASB in cell types
- HepG2 (hepatoblastoma) SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.28 | 0.88 | 1.15 | |||
| SK-N-SH (neuroblastoma) | 0.12 | 1.38 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, comorbid depressive syndrome and alcohol dependence, glaucoma, height, late onset alzheimers disease, major depressive disorder, obesity with early age of onset (age >2), type 1 diabetes, rheumatoid arthritis, crohns disease, combined case analysis, variant creutzfeldt-jakob disease