rs11678980 chr2:161244750 G>A
- Sequence
cttcctcccctccagagtgccccg[G/A]cgtctttctagcctccgcctccag
- ASB in cell types
- HEK293T (embryonic kidney) GM12878 (female B-cells) transverse colon
- ASB for transcription factors
- ZFX_HUMAN CTCF_HUMAN FOXK2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZFX_HUMAN | 2.29 | -1.77 | 2.00 | n/a | No Hit | |||
| CTCF_HUMAN | 0.99 | 0.27 | 1.35 | n/a | No Hit | |||
| FOXK2_HUMAN | 2.44 | 0.60 | 1.75 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
EMBL-EBI cognitive performance, cognitive performance (mtag), educational attainment (mtag), educational attainment (years of education), highest math class taken, highest math class taken (mtag), self-reported math ability, self-reported math ability (mtag), smoking initiation (ever regular vs never regular), smoking initiation (ever regular vs never regular) (mtag)
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Brain_Spinal_cord_cervical_c-1, Breast_Mammary_Tissue, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Esophagus_Mucosa, Kidney_Cortex, Liver, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Uterus, Vagina, Whole_Blood