rs11803731 chr1:152110849 A>T
- Sequence
gctgcctctcccgctgctcccgca[A/T]tgggggcctggccgacagcctctg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) MCF-7 C4-12 (invasive breast ductal carcinoma)
- ASB for transcription factors
- ZFX_HUMAN SUMO2_HUMAN RCOR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZFX_HUMAN | 2.76 | -0.25 | 2.20 | n/a | No Hit | |||
| SUMO2_HUMAN | 2.11 | -1.24 | 2.00 | n/a | n/a | |||
| RCOR1_HUMAN | 2.37 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, cystatin c in serum, hair morphology, hair morphology (adolescent), hair morphology (straight or curly), hair morphology (straight, wavy, or curly)
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cortex, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid