rs12402922 chr1:199202675 C>T
- Sequence
gatcctccattacctgaattagtg[C/T]ggtattcaaggcactttgcaattt
- ASB for transcription factors
- MYB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MYB_HUMAN | 0.93 | 0.00 | 1.45 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP barnes akathisia rating scale, serum creatinine, sporadic creutzfeldt-jakob disease, tardive dyskinesia, triglycerides change with statins