rs12576239 chr11:2481089 C>T
- Sequence
catgttggatttcactcatagcca[C/T]gagaacgggtggtggtctcttctg
- ASB for transcription factors
- TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 2.17 | n/a | 2.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP heart rate, implantable cardioverter-defibrillator activation with life-threatening arrhythmias, partial epilepsy, qt interval, total cholesterol
PheWAS adrenal hyperfunction, adverse effects of antineoplastic and immunosuppressive drugs, adverse effects of opiates and related narcotics in therapeutic use, amblyopia, anaphylactic shock nos, atrophy of edentulous alveolar ridge, back pain, benign neoplasm of brain and other parts of nervous system, benign neoplasm of other endocrine glands, benign neoplasm of uterus, cerebral atherosclerosis, chronic osteomyelitis, congenital musculoskeletal anomalies, contracture of joint, convulsions, disorders of uterus, nec, displacement of intervertebral disc, enthesopathy, epilepsy, recurrent seizures, convulsions, gouty arthropathy, hammer toe, hearing loss, heart valve replaced, hereditary hemolytic anemias, idiopathic fibrosing alveolitis, intervertebral disc disorders, iron deficiency anemia secondary to blood loss, lesions of stomach and duodenum, lipoprotein disorders, multiple sclerosis, noninfectious gastroenteritis, other cardiac conduction disorders, other disorders of back, other disorders of lipoid metabolism and hyperalimentation, other disorders of metabolic, endocrine, immunity disorders, other hereditary hemolytic anemias, other symptoms referable to back, other upper respiratory disease, painful respiration, paralysis/spasm of vocal cords or larynx, paranoid disorders, pelvic inflammatory disease, peripheral retinal degenerations, personal history of allergy to medicinal agents, poisoning by primarily systemic agents, postinflammatory pulmonary fibrosis, scar conditions and fibrosis of skin, sensorineural hearing loss, spinal stenosis, spontaneous ecchymoses, strabismus (not specified as paralytic), supraventricular premature beats, synoviopathy, systemic sclerosis, thoracic neuritis/radiculitis, urethral hypermobility/isd