Attention! You are using release Soos. You can switch to the latest ADASTRA version: adastra.autosome.org

rs12608504 chr19:18278325 A>G

Sequence
cccctgctctcccacctcagcctc[A/G]gttcccttcagcaggttccttcag
ASB in cell types
HEK293 (embryonic kidney) keratinocytes
ASB for transcription factors
SNAI2_HUMAN

Color scale

color scale ref
-log10 FDR of Ref (A) ASB
color scale alt
-log10 FDR of Alt (G) ASB

Details

Uniprot ID
Effect size Ref
Effect size Alt
FDR Ref
FDR Alt
Mean BAD
Motif fold change
Motif concordance
SNAI2_HUMAN 2.00 n/a 2.0·10-31.00 1.33 n/a No Hit
Items per page:
1 – 1 of 1

Motif analysis

No data available

Genetic associations

EMBL-EBI waist circumference adjusted for bmi (adjusted for smoking behaviour) waist circumference adjusted for bmi (joint analysis main effects and smoking interaction) waist circumference adjusted for bmi in non-smokers waist circumference adjusted for body mass index waist-to-hip ratio adjusted for bmi waist-to-hip ratio adjusted for bmi (adjusted for smoking behaviour) waist-to-hip ratio adjusted for bmi (joint analysis main effects and smoking interaction) waist-to-hip ratio adjusted for bmi in non-smokers waist-to-hip ratio adjusted for bmi x sex x age interaction (4df test) waist-to-hip ratio adjusted for body mass index
GRASP arthritis including non-rheumatoid fasting insulin hdl cholesterol hip bone mineral density (bmd) homa-b homa-ir hypertension (early onset hypertension) irritible bowel syndrome ldl cholesterol ldl cholesterol change with statins longstanding arthritis total cholesterol total cholesterol change with statins triglycerides waist hip ratio
GTEx eQTL Adipose_Subcutaneous Adipose_Visceral_Omentum Adrenal_Gland Artery_Aorta Artery_Coronary Artery_Tibial Brain_Amygdala Brain_Caudate_basal_ganglia Brain_Cerebellar_Hemisphere Brain_Cerebellum Brain_Cortex Brain_Frontal_Cortex_BA9 Brain_Hippocampus Brain_Hypothalamus Brain_Nucleus_accumbens_basal_ganglia Brain_Putamen_basal_ganglia Brain_Spinal_cord_cervical_c-1 Brain_Substantia_nigra Breast_Mammary_Tissue Cells_Cultured_fibroblasts Colon_Sigmoid Colon_Transverse Esophagus_Gastroesophageal_Junction Esophagus_Mucosa Esophagus_Muscularis Heart_Atrial_Appendage Heart_Left_Ventricle Lung Muscle_Skeletal Nerve_Tibial Ovary Pancreas Pituitary Prostate Skin_Not_Sun_Exposed_Suprapubic Skin_Sun_Exposed_Lower_leg Small_Intestine_Terminal_Ileum Spleen Stomach Thyroid Vagina Whole_Blood

Download