rs12740374 chr1:109274968 G>T
- Sequence
agtgctggctcggctgccctgagg[G/T]tgctcaatcaagcacaggtttcaa
- ASB in cell types
- cranial neural crest cells
- ASB for transcription factors
- AP2A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| AP2A_HUMAN | 2.77 | -0.10 | 1.67 | -3.93 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
EMBL-EBI blood protein levels, cardiovascular disease, cholesterol, total, coronary artery disease, height, high density lipoprotein cholesterol levels, ldl cholesterol, lipoprotein phospholipase a2 activity in cardiovascular disease, lipoprotein-associated phospholipase a2 activity and mass, low density lipoprotein cholesterol levels, medication use (antithrombotic agents), medication use (hmg coa reductase inhibitors), total cholesterol levels
GRASP advanced age-related macular degeneration (geographic atrophy), apob (apolipoprotein b), celsr2 gene expression in human liver, coronary artery disease (cad), hdl cholesterol, height, large ldl cholesterol by nmr, ldl cholesterol, ldl cholesterol (female), ldl cholesterol (male), ldl cholesterol change with statins, ldl cholesterol exam 1 values, ldl cholesterol in serum, lipoprotein-associated phospholipase a2 activity (lp-pla2), lp-pla2 activity, metabolic syndrome domains (atherogenic dyslipidemia - pc1), metabolic syndrome domains (multivariate analysis), prop taste detection threshold, psrc1 gene expression in human liver, serum butyrylcholinesterase activity, small hdl cholesterol by nmr, small ldl cholesterol by nmr, small vldl cholesterol concentration by nmr, sort1 gene expression in human liver, total cholesterol, total cholesterol (exam 1), total cholesterol change with statins, total cholesterol to hdl cholesterol ratio, vldl cholesterol size by nmr
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Brain_Cortex, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Mucosa, Heart_Left_Ventricle, Liver, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood