rs136820 chr22:39642070 T>C
- Sequence
gggggcagcgggagggctgaactc[T/C]gctgcctccgctgccctgcgctgc
- ASB in cell types
- erythroid cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | 1.76 | -1.61 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, hdl cholesterol, hdl cholesterol change with statins, waist hip ratio, years of education