rs140522 chr22:50532837 T>C
- Sequence
gcacacactccatttaattatgtg[T/C]agagagaggacttatctatttaag
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.49 | 0.30 | 1.31 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI chronic lymphocytic leukemia, mean corpuscular hemoglobin, mean corpuscular volume, multiple sclerosis, red blood cell count, red blood cell traits, red cell distribution width, reticulocyte count
GRASP high-grade glioma, mean corpuscular hemoglobin (mch), mean corpuscular hemoglobin concentration (mchc), mean corpuscular volume (mcv), multiple sclerosis, neuroblastoma (brain cancer), red blood cell count (rbc), salmonella-induced pyroptosis, triglycerides, waist hip ratio
PheWAS acute reaction to stress, adverse effects of antibacterials (not penicillins), anomalies of pupillary function, anterior pituitary disorders, arthropathy nos, benign neoplasm of thyroid glands, bladder neck obstruction, breast conditions, congenital or relating to hormones, cachexia, candidiasis, chronic kidney disease, stage i or ii, chronic pancreatitis, congenital anomalies of intestine, congenital anomalies of limbs, congenital anomalies of urinary system, congenital cataract and lens anomalies, cyst and pseudocyst of pancreas, cystic kidney disease, disorders of the autonomic nervous system, drug-resistant infection, dysmetabolic syndrome x, esophageal atresia/tracheoesophageal fistula, essential tremor, fracture of ankle and foot, fracture of humerus, genitourinary congenital anomalies, hemorrhage of rectum and anus, hypertension complicating pregnancy, hypertensive heart disease, hypertrophy of breast (gynecomastia), kidney replaced by transpant, light-headedness and vertigo, macular puckering of retina, malunion fracture, methicillin resistant staphylococcus aureus, migrain with aura, nonspecific findings on examination of blood, open-angle glaucoma, osteoarthrosis, generalized, other acute and subacute forms of ischemic heart disease, other disorders of arteries and arterioles, other disorders of intestine, other forms of chronic heart disease, other peripheral nerve disorders, other symptoms involving abdomen and pelvis, pathological, developmental or recurrent dislocation, peripheral autonomic neuropathy, peritonitis and retroperitoneal infections, personal history of allergy to medicinal agents, posttraumatic stress disorder, renal dialysis, renal failure, spasm of muscle, supraventricular premature beats, symptoms and disorders of the joints, tachycardia nos, type 1 diabetic neuropathy, varicose veins of lower extremity, vitamin b12 deficiency anemia
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Brain_Cortex, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood