rs143384 chr20:35437976 G>A
- Sequence
accaaagagaacagcggcagcagc[G/A]aaggtgcctctggtttggcaggaa
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.19 | 0.52 | 2.03 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI anthropometric traits, anthropometric traits (multi-trait analysis), body fat distribution (leg fat ratio), body fat distribution (trunk fat ratio), developmental dysplasia of the hip, fat-free mass, femoral neck size, fev1, height, hip bone size, hip circumference, hip circumference adjusted for bmi, infant length, intertrochanteric region size, joint mobility (beighton score), knee osteoarthritis, lung function (fvc), peak expiratory flow, spine bone size, trochanter size, waist-hip ratio, weight
GRASP birth weight and adult height, chronic kidney disease, diastolic blood pressure (dbp), gene expression, height, height (pubertal), intracranial volume, ldl cholesterol, lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc), obesity with early age of onset (age >2), total cholesterol, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood