Attention! You are using release Soos. You can switch to the latest ADASTRA version: adastra.autosome.org

rs143384 chr20:35437976 G>A

Sequence
accaaagagaacagcggcagcagc[G/A]aaggtgcctctggtttggcaggaa
ASB in cell types
HEK293 (embryonic kidney)

Color scale

color scale ref
-log10 FDR of Ref (G) ASB
color scale alt
-log10 FDR of Alt (A) ASB

Details

Cell type
Effect size Ref
Effect size Alt
FDR Ref
FDR Alt
Mean BAD
HEK293 (embryonic kidney) -0.19 0.52 1.000.02 2.03
Items per page:
1 – 1 of 1

Motif analysis

No data available

Genetic associations

EMBL-EBI anthropometric traits anthropometric traits (multi-trait analysis) body fat distribution (leg fat ratio) body fat distribution (trunk fat ratio) developmental dysplasia of the hip fat-free mass femoral neck size fev1 height hip bone size hip circumference hip circumference adjusted for bmi infant length intertrochanteric region size joint mobility (beighton score) knee osteoarthritis lung function (fvc) peak expiratory flow spine bone size trochanter size waist-hip ratio weight
GRASP birth weight and adult height chronic kidney disease diastolic blood pressure (dbp) gene expression height height (pubertal) intracranial volume ldl cholesterol lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc) obesity with early age of onset (age >2) total cholesterol waist hip ratio
GTEx eQTL Adipose_Subcutaneous Adipose_Visceral_Omentum Adrenal_Gland Artery_Aorta Artery_Tibial Brain_Caudate_basal_ganglia Brain_Cerebellar_Hemisphere Brain_Frontal_Cortex_BA9 Brain_Hippocampus Brain_Hypothalamus Brain_Nucleus_accumbens_basal_ganglia Brain_Putamen_basal_ganglia Breast_Mammary_Tissue Cells_Cultured_fibroblasts Cells_EBV-transformed_lymphocytes Colon_Sigmoid Colon_Transverse Esophagus_Gastroesophageal_Junction Esophagus_Mucosa Esophagus_Muscularis Heart_Atrial_Appendage Heart_Left_Ventricle Lung Minor_Salivary_Gland Muscle_Skeletal Nerve_Tibial Pancreas Pituitary Prostate Skin_Not_Sun_Exposed_Suprapubic Skin_Sun_Exposed_Lower_leg Spleen Stomach Testis Thyroid Whole_Blood

Download