rs1447295 chr8:127472793 A>C
- Sequence
gtgccattggggaggtatgtaaaa[A/C]gtgctatggaaaaaaagcaacagg
- ASB in cell types
- monocyte-derived dendritic cells
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | -2.01 | 1.70 | 2.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP height, prostate cancer, prostate cancer (advanced prostate cancer), prostate cancer (non-advanced prostate cancer), prostate cancer aggressiveness, serum prostate-specific antigen (psa)
PheWAS abnormal involuntary movements, abnormal serum enzyme levels, acquired hemolytic anemias, acute cystitis, agorophobia, social phobia, and panic disorder, anomalies of pupillary function, arthropathy associated with infections, attention deficit hyperactivity disorder, behcets syndrome, blister, blood in stool, cholangitis, claw toe, contracture of joint, cystitis, diseases of esophagus, diseases of the jaws, disorders of cervical region, disorders of function of stomach, dyschromia and vitiligo, dyspareunia, endometriosis, epiphora, esophagitis, gerd and related diseases, essential hypertension, hemorrhage of rectum and anus, hepatic cancer, primary, hypertension, hypertensive chronic kidney disease, hypertensive heart and/or renal disease, hypocalcemia, infertility, male, inflammation of eyelids, intracerebral hemorrhage, keratitis, keratitis, infectious, known or suspected fetal abnormality, lack of normal physiological development, large cell lymphoma, localized adiposity, malignant neoplasm of brain and nervous system, mechanical complication due to other implant and internal device, nerve plexus lesions, nerve root and plexus disorders, oliguria and anuria, open wound of nose and sinus, other biliary tract disease, other disorders of biliary tract, other disorders of bone and cartilage, other dyschromia, other peripheral nerve disorders, other symptoms involving abdomen and pelvis, other unspecified back disorders, pancreatic cancer, paralytic strabismus, photodermatitis & sunburn, progressive myopia, prostate cancer, pulmonary congestion and hypostasis, pyogenic arthritis, random mental disorder. ignored for now, redundant prepuce and phimosis/bxo, secondary malignant neoplasm, secondary malignant neoplasm of liver, sexual and gender identity disorders, sinoatrial node dysfunction, speech and language disorder, suppurative and unspecified otitis media, torticollis, unspecified polyarthropathy or polyarthritis