rs157580 chr19:44892009 G>A
- Sequence
tcacggtgtcagcaaggtgtcagc[G/A]aggttccttgggtatgggacccaa
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.60 | -0.23 | 2.01 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI alzheimers disease, alzheimers disease biomarkers, alzheimers disease or family history of alzheimers disease, cerebrospinal fluid p-tau181p:ab1-42 ratio, cerebrospinal fluid t-tau:ab1-42 ratio, family history of alzheimers disease, hdl cholesterol, ldl cholesterol, triglyceride levels
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy), alzheimers disease, alzheimers disease (age of onset), alzheimers disease (apoe4 positive), apob (apolipoprotein b), cognitive ageing, cognitive ageing (females), cystatin c in serum, hdl cholesterol, hippocampal volume, total cerebral volume, white matter hyperintensities in alzheimers disease patients, late onset alzheimers disease, ldl cholesterol, ldl cholesterol (female), ldl cholesterol (male), ldl cholesterol (mmol/l), ldl cholesterol change with statins, myocardial infarction (mi), neuroblastoma (brain cancer), rosuvastatin induced percent change in c-reactive protein (crp), total cholesterol, total cholesterol change with statins, total cholesterol in females, total cholesterol in males, triglycerides, vldl cholesterol small lipoprotein fraction concentration, waist hip ratio
PheWAS abnormal coagulation profile, acquired spondylolisthesis, acute cystitis, acute prostatitis, acute upper respiratory infections, age-related macular degeneration, allergic rhinitis, allergies, other, alzheimers disease, anaphylactic shock nos, angiodysplasia of intestine, aseptic necrosis of bone, asthma, asthma with exacerbation, atherosclerosis of renal artery, atopic or contact dermatitis, back pain, bacterial pneumonia, benign neoplasm of lip, oral cavity, and pharynx, bronchiectasis, calcium/phosphorus disorders, cholelithiasis and cholecystitis, cholelithiasis with other cholecystitis, chronic airway obstruction, chronic glomerulonephritis, chronic obstructive asthma, chronic pharyngitis and nasopharyngitis, chronic renal failure, chronic sinusitis, chronic tonsillitis and adenoiditis, contact and allergic dermatitis of eyelid, contact dermatitis and other eczema due to plants [except food], cyst and pseudocyst of pancreas, decubitus ulcer, degeneration of intervertebral disc, delirium dementia and amnestic disorders, dementias, deviated nasal septum, diseases of sebaceous glands, diseases of the oral soft tissues, disorders of function of stomach, disorders of lacrimal system, disorders of mineral metabolism, disorders of synovium, tendon, and bursa, dry eyes, dyshidrosis, dyspepsia and disorders of function of stomach, e. coli, elevated blood pressure reading, elevated prostate specific antigen, empyema and pneumothorax, enthesopathy, epistaxis or throat hemorrhage, erectile dysfunction, facial nerve disorders, fracture of pelvis, hyperplasia of prostate, hyperpotassemia, hypertensive heart and/or renal disease, hypertensive heart disease, hypocalcemia, inflammation of eyelids, inflammation of the eye, inflammatory disease of cervix, vagina, and vulva, inflammatory diseases of female pelvic organs, insomnia, intervertebral disc disorders, known or suspected fetal abnormality, localized superficial swelling, mass, or lump, lump or mass in breast, macular degeneration, macular degeneration, dry, macular degeneration, wet, male genital disorders, mastodynia, memory loss, mental disorders due to brain damage, neurological disorders due to brain damage, nonsenile cataract, nonspecific findings on examination of blood, other acquired musculoskeletal deformity, other disorders of the nervous system, other disorders of urethra and urinary tract, other headache syndromes, other peripheral nerve disorders, other specified nonpsychotic and/or transient mental disorders, other upper respiratory disease, pain in joint, pallor and flushing, parkinsons disease, peripheral enthesopathies, persistent mental disorders due to other conditions, prostate cancer, pruritus and related conditions, pseudomonal pneumonia, rash and other nonspecific skin eruption, renal osteodystrophy, retinal disorders, schizophrenia and other psychotic disorders, seborrheic keratosis, secondary malignant neoplasm of digestive systems, senile dementia, sleep disorders, somatoform disorder, spondylosis and allied disorders, spondylosis without myelopathy, stiffness of joint, stomatitis and mucositis, strabismus (not specified as paralytic), supraventricular premature beats, symptoms affecting skin, symptoms and disorders of the joints, symptoms associated with female genital organs, symptoms involving respiratory system, testicular dysfunction, testicular hypofunction, tinnitus, urethral hypermobility/isd, uveitis, vaginitis and vulvovaginitis, viral pneumonia