Attention! You are using release Soos. You can switch to the latest ADASTRA version: adastra.autosome.org

rs1876518 chr2:65381775 C>T

Sequence
gtaatatcctctagcaaatgggaa[C/T]tgtgcaattcaacaggttctgcct
ASB in cell types
GM12878 (female B-cells)
ASB for transcription factors
IKZF1_HUMAN

Color scale

color scale ref
-log10 FDR of Ref (C) ASB
color scale alt
-log10 FDR of Alt (T) ASB

Details

Uniprot ID
Effect size Ref
Effect size Alt
FDR Ref
FDR Alt
Mean BAD
Motif fold change
Motif concordance
IKZF1_HUMAN 1.48 -1.27 3.8·10-41.00 1.33 n/a No Hit
Items per page:
1 – 1 of 1

Motif analysis

No data available

Genetic associations

EMBL-EBI celiac disease or rheumatoid arthritis
GRASP anti-tnf treatment response in rheumatoid arthritis (by das-28 score change at 3 months) aortic valve calcium celiac disease common variable immunodeficiency rheumatoid arthritis rheumatoid arthritis and celiac disease salmonella-induced pyroptosis sporadic creutzfeldt-jakob disease triglycerides
PheWAS abnormal findings on exam of gastrointestinal tract/abdominal area abnormal reflex acute osteomyelitis allergic rhinitis arthropathy nos arthropathy nos involving multiple sites atrophic gastritis bladder neck obstruction bronchopneumonia and lung abscess cardiomegaly chronic bronchitis colles fracture complex regional/central pain syndrome costochondritis deficiency anemias nos dental caries dupuytrens disease dyschromia and vitiligo epistaxis or throat hemorrhage gastroparesis hemiplegia hyperbilirubinemia hypocalcemia iron metabolism disorder keloid scar leukoplakia of oral mucosa male genital disorders noninfectious disorders of lymphatic channels obstructive chronic bronchitis oral aphthae osteoarthrosis, generalized osteochondropathies other conditions of brain, nos other disorders of adrenal glands other disorders of urethra and urinary tract other dyschromia pathological, developmental or recurrent dislocation poisoning by water, mineral, and uric acid metabolism drugs polymyalgia rheumatica sleep disorders stress incontinence, female toxic erythema vascular insufficiency of intestine
GTEx eQTL Ovary Thyroid

Download