rs198851 chr6:26104404 T>G
- Sequence
tggatgacagaaataaccgtgaca[T/G]cctgcataagaatgaattgtgttt
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) GM12878 (female B-cells) foreskin keratinocyte
- ASB for transcription factors
- NFXL1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NFXL1_HUMAN | n/a | 1.72 | 1.33 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI diastolic blood pressure x alcohol consumption (light vs heavy) interaction (2df test), diastolic blood pressure x alcohol consumption interaction (2df test), high light scatter reticulocyte percentage of red cells, mean arterial pressure x alcohol consumption (light vs heavy) interaction (2df test), mean corpuscular hemoglobin, mean corpuscular volume, medication use (diuretics), red cell distribution width, systolic blood pressure
GRASP diastolic blood pressure (dbp), hematocrit (hct), hemoglobin (hb), ldl cholesterol, mean cell volume (mcv), mean cell hemoglobin (mch), hemoglobin (hgb), hematocrit (hct), mean cell hemoglobin concentration (mchc), mean corpuscular hemoglobin (mch), mean corpuscular hemoglobin concentration (mchc), mean corpuscular volume (mcv), rheumatoid arthritis, serum creatinine, systolic blood pressure (sbp), triglycerides
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Uterus, Whole_Blood