rs20549 chr16:67936027 A>G
- Sequence
cgcggggctcgcggcccgtagata[A/G]cgcgtgtagctccatcttggacgc
- ASB in cell types
- K562 (myelogenous leukemia) HepG2 (hepatoblastoma) CD14+ monocytes MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- STAT1_HUMAN MNT_HUMAN NRF1_HUMAN CLOCK_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 1.86 | n/a | 2.50 | n/a | No Hit | |||
| MNT_HUMAN | -0.87 | 1.78 | 2.12 | n/a | n/a | |||
| NRF1_HUMAN | -0.95 | 1.81 | 2.00 | n/a | No Hit | |||
| CLOCK_HUMAN | 2.10 | -1.79 | 2.00 | n/a | No Hit | |||
| ESR1_HUMAN | 1.90 | -3.82 | 2.50 | n/a | No Hit |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), hdl cholesterol, red blood cell count (rbc), total cholesterol, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood