rs206936 chr6:34335092 A>G
- Sequence
ataaagcatgaacaataccacagt[A/G]ctagaaatacagactgcaatggaa
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.72 | 0.00 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bmi in adolescence/young adulthood, bmi tails (upper and lower 5th percentiles), body mass index (bmi), body mass index (bmi) >25 kg/m2, body mass index (bmi) >30 kg/m2, body mass index (bmi) >35 kg/m2, body mass index (bmi) >40 kg/m2, brachial circumference , coronary artery disease (cad), extreme obesity (body mass index (bmi)), extreme obesity with early age of onset, gene expression, height, obesity (body mass index (bmi) > 30 kg/m2)), overweight (body mass index (bmi) > 25 kg/m2)), parkinsons disease, serum creatinine, tardive dyskinesia, weight
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Liver, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood