rs209473 chr6:32955131 A>C
- Sequence
gctaccagctattgccagccaccg[A/C]cactgtttagaggctgaagcagga
- ASB in cell types
- LNCaP C4-2B (prostate carcinoma) SK-N-SH (neuroblastoma) GM12878 (female B-cells) esophagus squamous epithelium
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP C4-2B (prostate carcinoma) | 1.94 | -0.07 | 1.33 | |||
| SK-N-SH (neuroblastoma) | 1.64 | -1.26 | 1.33 | |||
| GM12878 (female B-cells) | -1.27 | 1.51 | 1.33 | |||
| esophagus squamous epithelium | 1.05 | -0.64 | 1.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, crohns disease, hdl cholesterol, kawasaki disease, kawasaki disease (excluding controls with chronic hepatitis b, drug eruption and tuberculosis), parkinsons disease, primary biliary cirrhosis, primary biliary cirrhosis (antimitochondrial-antibody positive only), type 1 diabetes, variant creutzfeldt-jakob disease
GTEx eQTL Brain_Cerebellum, Brain_Cortex, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Thyroid, Whole_Blood