rs2159177 chr14:73886623 C>T
- Sequence
ttcgggcttcgcggacataggagt[C/T]ccgaaggccgagagtgagtgagtg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) MDA-MB-453 (breast adenocarcinoma) fetal bone marrow-derived mononuclear cells GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.15 | 0.89 | 1.52 | |||
| MDA-MB-453 (breast adenocarcinoma) | 1.57 | -0.41 | 2.00 | |||
| fetal bone marrow-derived mononuclear cells | -2.25 | 1.88 | 1.50 | |||
| GM12878 (female B-cells) | 1.33 | n/a | 1.33 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, adiponectin levels, bipolar disorder, body mass index (bmi), rheumatoid arthritis
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Uterus, Vagina, Whole_Blood