rs2298428 chr22:21628603 C>T
- Sequence
gccgctcccaagagcaagagaaag[C/T]gtcggggccttcaccgcagccgcc
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney)
- ASB for transcription factors
- MEIS2_HUMAN MNT_HUMAN HDAC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MEIS2_HUMAN | n/a | 2.33 | 4.00 | n/a | No Hit | |||
| MNT_HUMAN | n/a | 3.20 | 6.00 | n/a | n/a | |||
| HDAC1_HUMAN | n/a | 2.85 | 6.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP anti-dsdna autoantibody status in systemic lupus erythematosus (sle) patients, aortic valve calcium, celiac disease, hdl cholesterol, height, hip bone mineral density (bmd), irritible bowel syndrome, mean corpuscular volume (mcv), rheumatoid arthritis, rheumatoid arthritis and celiac disease, spine bone mineral density (bmd), sporadic creutzfeldt-jakob disease, systemic lupus erythematosus (sle), total cholesterol, triglycerides, ube2l3 expression, ube2l3 gene expression in blood
PheWAS abdominal hernia, abnormal papanicolaou smear of cervix and cervical hpv, abnormal sputum, acquired toe deformities, acute laryngitis and tracheitis, adverse effects of adrenal cortical steroids, aseptic necrosis of bone, benign neoplasm of uterus, breast conditions, congenital or relating to hormones, calculus of lower urinary tract, cancer of oropharynx, cancer, suspected or other, cellulitis and abscess of hand/fingers, chronic pancreatitis, chronic prostatitis, concussion, congenital musculoskeletal anomalies, diabetic retinopathy, disorders of parathyroid gland, disorders of penis, diverticulitis, esophageal bleeding, esophageal cancer, gouty arthropathy, h. pylori, history of diseases of digestive system, idiopathic fibrosing alveolitis, inflammatory bowel disease, insomnia, intestinal malabsorption nos, late effects of cerebrovascular disease, mechanical complication of nervous system device, implant, and graft, migrain with aura, muscle weakness, musculoskeletal symptoms referable to limbs, occlusion and stenosis of precerebral arteries, osteoarthrosis, localized, secondary, other alveolar and parietoalveolar pneumonopathy, other derangement of joint, other hypertrophic and atrophic conditions of skin, other nonmalignant breast conditions, other paralytic syndromes, other symptoms referable to back, periostitis, peripheral or central vertigo, phosphorus metabolism disorder, poisoning by hormones and synthetic substitutes, poisoning by other anti-infectives, polyarthropathy or polyarthritis involving multiple sites nos, posttraumatic wound infection, primary thrombocytopenia, prostatitis, respiratory abnormalities, sacroiliitis nec, sarcoidosis, scleritis and episcleritis, skin neoplasm of uncertain behavior, speech and language disorder, stricture/obstruction of ureter, subarachnoid hemorrhage, sulfonamides, tobacco use disorder, unspecified polyarthropathy or polyarthritis, urethritis and urethral syndrome, uterine leiomyoma
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Uterus, Vagina, Whole_Blood