rs242557 chr17:45942346 G>A
- Sequence
aaagcagttggcttcgcccagggt[G/A]caccaggacacggttttggctctg
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 1.07 | -0.80 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, alzheimers disease, height, hip bone mineral density (bmd), infant head circumference, ldl cholesterol, parkinsons disease, progressive supranuclear palsy, years of education
PheWAS abnormal cytological, histological, immunological and dna test findings, abnormal pulmonary function, abnormal tumor markers, elevated cea or ca 125, acute upper respiratory infections, adverse drug events and drug allergies, adverse effects of hormones and synthetic substitutes, adverse effects of insulins and antidiabetic agents, alcohol-related disorders, alcoholic liver damage, alcoholism, allergic reaction to food, anisometropia, ankylosis of joint, anticoagulants causing adverse effects, benign neoplasm of colon, breast cancer, breast cancer, including in situ, cachexia, cancer, suspected or other, cardiomyopathy, cataract, cellulitis and abscess of leg, chronic bronchitis, chronic cystitis, chronic lymphoid leukemia, chronic pain syndrome, chronic venous hypertension, conduct disorders, cornea replaced by transplant, corneal opacity, decreased libido, degenerative disease of the spinal cord, dental caries, diabetic retinopathy, diseases of hard tissues of teeth, diseases of the salivary glands, disorders of cornea, disorders of other cranial nerves, disorders of sacrum, disturbances of sensation of smell and taste, elevated levels of transaminase or lactic acid dehydrogenase, endometriosis, eustachian tube disorders, femoral hernia, gingivitis, gross hematuria, heartburn, hematemesis, hemoptysis, hyperosmolality and/or hypernatremia, hypertension complicating pregnancy, hyperventilation, impacted cerumen, infection of the eye, intracranial hemorrhage (injury), keratitis, infectious, lupus erythematosus, macular puckering of retina, mechanical complications of cardiac/vascular device, implant, and graft, mental disorders due to brain damage, migraine, neck pain, nephritis and nephropathy in diseases classified elsewhere, neurological disorders due to brain damage, noninfectious disorders of lymphatic channels, nonrheumatic mitral valve disorders, occlusion of cerebral arteries, occlusion of cerebral arteries, with cerebral infarction, open wound of hand except finger(s), open wounds of extremities, osteoarthrosis, generalized, osteopenia, otalgia, other disorders of back, other disorders of soft tissues, other hypertrophic and atrophic conditions of skin, other nonmalignant breast conditions, other specified disorders of breast, other specified nonpsychotic and/or transient mental disorders, pain in limb, pallor and flushing, poisoning by agents primarily affecting blood constituents, polyarthropathy or polyarthritis involving multiple sites nos, polycythemia vera, secondary, primary open angle glaucoma, primary/intrinsic cardiomyopathies, prurigo, psoriasis, schizophrenia, schizophrenia and other psychotic disorders, shock, sprains and strains, subarachnoid hemorrhage (injury), subdural hemorrhage, subdural hemorrhage (injury), superficial cellulitis and abscess, swelling, mass, or lump in head and neck, symptoms involving head and neck, thoracic neuritis/radiculitis, trigeminal nerve disorders, type 1 diabetes, type 2 diabetic nephropathy, uveitis
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Kidney_Cortex, Liver, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Uterus, Vagina, Whole_Blood