rs2721051 chr13:40536747 C>T
- Sequence
agccaaatatcctgccagccagca[C/T]ggacctgctcccaagaatcatgtg
- ASB in cell types
- HepG2 (hepatoblastoma) MDA-MB-453 (breast adenocarcinoma)
- ASB for transcription factors
- FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 2.30 | -3.18 | 1.75 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI central corneal thickness, corneal hysteresis, corneal resistance factor, corneal structure, intraocular pressure
GRASP asthma, central corneal thickness, central corneal thickness in patients with an iop <= 21mmhg and no history of iop>= 21mmhg, keratoconus and primary open-angle glaucoma, ldl cholesterol change with statins, total cholesterol change with statins, tourettes syndrome
PheWAS abnormal findings on study of brain, nervous system, abnormal pulmonary function, abnormal results of function study of liver, abnormal tumor markers, elevated cea or ca 125, acid-base balance disorder, acne, acquired deformities of limbs, acute posthemorrhagic anemia, adrenal hyperfunction, anal and rectal polyp, anemia of chronic disease, aphakia and other disorders of lens, arthropathy associated with neurological disorders, benign neoplasm of other parts of digestive system, bronchiectasis, calcaneal spur, exostosis nos, carcinoma in situ of skin, cardiac defibrillator in situ, chronic pancreatitis, cysts of the jaws, degenerative disease of the spinal cord, dementia with cerebral degenerations, diabetes mellitus, disorders of cervical region, disorders of other cranial nerves, disorders of vitreous body, dyspepsia and disorders of function of stomach, early or threatened labor, hemorrhage in early pregnancy, hemorrhage from gastrointestinal ulcer, infection/inflammation of internal prosthetic device, implant or graft, injuries to the nervous system, lichen, magnesium metabolism disorder, megaloblastic anemia, methicillin resistant staphylococcus aureus, myoclonus, nasal polyps, neck pain, nerve root lesions, noninfectious dermatoses of eyelid, nontoxic nodular goiter, oral aphthae, other cerebral degenerations, other disorders of stomach and duodenum, other disorders of tympanic membrane, paraproteinemia, perforation of tympanic membrane, pernicious anemia, pernicious or b12 deficiency anemia, schizoid personality disorder, spondylolisthesis, congenital, stomatitis and mucositis, stress incontinence, female, trigeminal nerve disorders, type 1 diabetic neuropathy, type 1 diabetic retinopathy, type 2 diabetes, type 2 diabetic neuropathy, type 2 diabetic retinopathy, viral infection, vitamin d deficiency