rs278037 chr13:29850490 C>T
- Sequence
tctcctcagcccgggaatggtttc[C/T]tctcagagctttgtttctcctcct
- ASB in cell types
- HEK293T (embryonic kidney) CD14+ monocytes breast tumor tissue
- ASB for transcription factors
- ESR1_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 2.17 | n/a | 2.50 | n/a | No Hit | |||
| STAT1_HUMAN | 2.02 | -3.95 | 2.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP asthma, autism, bipolar disorder, decrease in fev1 (in nonasthmatic ever smokers), decrease in fev1 (in nonasthmatic never smokers), decrease in fev1 (in nonasthmatic participants >=30 years old), decrease in fev1 (in nonasthmatic participants), irritible bowel syndrome, lung function, forced expiratory volume in 1 second (fev1) percent predicted (in nonasthmatic participants), obesity with early age of onset (age >2), parkinsons disease, salmonella-induced pyroptosis, serum creatinine