rs2923084 chr11:10367235 A>G
- Sequence
tccttccctgctaactgagacaac[A/G]tgtatgtccagcctttctgttcag
- ASB in cell types
- PANC1 (pancreatic ductal adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| PANC1 (pancreatic ductal adenocarcinoma) | -2.23 | 2.00 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, asthma, college completion, hdl cholesterol, ldl cholesterol, triglycerides, years of education
PheWAS actinic keratosis, acute pericarditis, adverse effects of antineoplastic and immunosuppressive drugs, alzheimers disease, antihypertensive agents causing adverse effects, benign neoplasm of breast, benign neoplasm of respiratory and intrathoracic organs, bipolar, blindness and low vision, carcinoma in situ of skin, cardiac defibrillator in situ, cardiac pacemaker/device in situ, carditis, chronic obstructive asthma, congenital anomalies of genital organs, decreased libido, delirium dementia and amnestic disorders, delirium due to conditions classified elsewhere, dementias, dermatosis nos, diseases of lips, disorders of function of stomach, disorders of the globe, diverticulum of esophagus, acquired, dyspepsia and disorders of function of stomach, erythematous conditions, facial nerve disorders, functional disorders of bladder, gastric ulcer, gross hematuria, hallucinations, hemorrhage or hematoma complicating a procedure, lack of coordination, nevus, non-neoplastic, non-melanoma skin cancer, occlusion and stenosis of precerebral arteries, osteoarthrosis, localized, secondary, other biliary tract disease, other dermatoses, other disorders of gallbladder, other disorders of the nervous system, other specified gastritis, pallor and flushing, pelvic inflammatory disease, peptic ulcer, pericarditis, pneumococcal pneumonia, poisoning by primarily systemic agents, posttraumatic wound infection, restless legs syndrome, scleritis and episcleritis, seborrheic keratosis, secondary malignancy of bone, secondary malignancy of lung, secondary malignant neoplasm of digestive systems, skin cancer, sleep related movement disorders, thyrotoxicosis, unspecified erythematous condition, urinary obstruction, vitamin deficiency