rs319597 chr5:134905755 G>A
- Sequence
tcctgctgtagaaattaatatttt[G/A]gagtaaatggagggaaagttttaa
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells) HEK293T (embryonic kidney) foreskin keratinocyte
- ASB for transcription factors
- ENL_HUMAN IKZF1_HUMAN FOXK2_HUMAN ZNF24_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ENL_HUMAN | 2.01 | -1.27 | 2.00 | n/a | n/a | |||
| IKZF1_HUMAN | 2.31 | -3.08 | 2.00 | n/a | No Hit | |||
| FOXK2_HUMAN | 1.64 | 0.42 | 1.67 | n/a | n/a | |||
| ZNF24_HUMAN | 1.32 | -0.29 | 1.73 | n/a | n/a | |||
| REST_HUMAN | 2.32 | -3.05 | 2.00 | n/a | No Hit |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, height, infant head circumference, mitral annular calcium, refractive error
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Nerve_Tibial, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood