rs339331 chr6:116888889 T>C
- Sequence
gcatgaactctctctccccagttt[T/C]atgaggtttatctttagtgactag
- ASB in cell types
- prostate tumor LHSAR (prostate epithelial cells) VCaP (prostate carcinoma)
- ASB for transcription factors
- HXB13_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HXB13_HUMAN | 2.60 | 0.21 | 1.75 | -4.27 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP diastolic blood pressure (dbp), fasting blood glucose, ldl cholesterol, maternal transmission distortion, prostate cancer, prostate cancer (advanced prostate cancer), prostate cancer (non-advanced prostate cancer), salmonella-induced pyroptosis, serum creatinine, total cholesterol
PheWAS abnormal chest sounds, abnormal findings on examination of urine, abnormal glucose, abnormal involuntary movements, abnormal kidney function, abnormal serum enzyme levels, acquired deformities of finger, acquired deformities of limbs, acquired toe deformities, acute periodontitis, acute sinusitis, antihypertensive agents causing adverse effects, asthma, atherosclerosis of native arteries of the extremities with ulceration or gangrene, benign neoplasm of skin, benign neoplasm of uterus, blister, bronchitis, bursitis, cancer of mouth, cancer of oropharynx, cancer within the respiratory system, carditis, cerebral edema and compression of brain, cervical radiculitis, chronic airway obstruction, chronic bronchitis, chronic lymphocytic thyroiditis, chronic osteomyelitis, chronic periodontitis, chronic pharyngitis and nasopharyngitis, chronic ulcer of leg or foot, chronic ulcer of skin, clotting factor deficiency, congenital anomalies of urinary system, cystic kidney disease, disorders of lipoid metabolism, disorders of other cranial nerves, disorders of vitreous body, duodenal ulcer, eating disorder, elevated c-reactive protein, erectile dysfunction, exostosis of jaw, fever of unknown origin, genital prolapse, gingival and periodontal diseases, glaucoma, gram negative septicemia, hallux valgus (bunion), hemiplegia, herpes zoster, hyperbilirubinemia, hypercholesterolemia, hyperlipidemia, hypotony of eye, impaired fasting glucose, infection/inflammation of internal prosthetic device, implant or graft, infections involving bone, inflammatory and toxic neuropathy, intestinal infection, intestinal malabsorption nos, keratoderma, acquired, light-headedness and vertigo, loss of teeth or edentulism, lung cancer, macular degeneration, mastoiditis, neoplasm of uncertain behavior, nervous system congenital anomalies, nonrheumatic mitral valve disorders, occlusion and stenosis of precerebral arteries, osteomyelitis, other abnormal glucose, other and unspecified disc disorder, other derangement of joint, other dermatoses, other diseases of the teeth and supporting structures, other hypertrophic and atrophic conditions of skin, other paralytic syndromes, pericarditis, periodontitis (acute or chronic), peripheral vascular disease, pityriasis, poisoning by psychotropic agents, prostate cancer, pseudoexfoliation glaucoma, respiratory failure, insufficiency, arrest, retinoschisis and retinal cysts, schizophrenia and other psychotic disorders, seborrheic keratosis, somatoform disorder, stomach cancer, subjective visual disturbances, symptoms involving female genital tract, thyroiditis, tinnitus, trigeminal nerve disorders, tuberculosis, urethral hypermobility/isd, vertiginous syndromes and other disorders of vestibular system, viral infection